Dr. McKean’s New Genetic Code

When he was working for the CIA, Dr. Peyton McKean created a means of writing English using the four code letters of the DNA genetic code (A, T, G and C). He assigned the 26 letters of the English alphabet to groups of three DNA letters, which geneticists call codons. Scientists already had such a code table, referred to as The Genetic Code, but it lacked assignments for 6 of the 26 letters of the English language. McKean fixed that, and came up with the modified code table below, which possesses a complete set of English letters. Notice the six “not equal” signs (≠). These mark the only codons of the original code that Dr. McKean needed to change to get his new DNA-to-English code.

This new code table allowed Dr. McKean to insert DNA into genetically modified organisms, carrying secret information in English sentences. Most DNA sequences are randomly scrambled letters that look like gibberish to the English reader, but now it is possible to conceal in the middle of an organism’s DNA, a sequence of seemingly random DNA letters:

ACGCATATCAGTTAAAGAGGTCGAAATAATAGCATG

which actually are the first letters of the phrase:

THISORGANISMWASOBTAINEDFROMUNITEDSTATESCLASSIFIEDSTOCKSITIS

ACRIMETOPOSSESSDISSEMINATEORGENETICALLYALTERTHEORGANISM

WITHOUTUNITEDSTATESGOVERNMENTCLEARANCE

When I asked him how he specifically uses his coded organisms, Dr. McKean flashed me that intellectual smirk of his and replied with the classic, “If I told you that, I’d have to kill you. Suffice it to say that microbes bearing messages hidden in their genomes have become a fact of life in national and international covert operations.”

I have a hunch that someday soon a criminal or espionage case involving such a microbe will be unveiled. Meanwhile, be Dr. McKean’s guest: try writing your own sentences in his code. Or, if you’re really ambitious, search within the human genome and find some words or sentences already written there by God or Nature. Who knows, maybe great revelations await, written in the A’s, T’s, G’s and C’s of your very own DNA?

More on this in a future post.